Materials for training


This page contains links to files used during GenoCAD training and data that can be copied and pasted during the tutorial.

  • Plant-optimized GFP:
    • Parts name: mgfp5-001
    • Sequence: agtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcaggagaggaccatcttcttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtcaacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcatggccgacaagcaaaagaacggcatcaaagccaacttcaagacccgccacaacatcgaagacggcggcgtgcaactcgctgatcattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaa
    • Description: suitable for expression in plants due to removal of a cryptic intron This part is included in plasmids pCAMBIA1302, pCAMBIA1303, pCAMBIA1304, and 1 other plasmids.
  • Genetic Insulator
    • Parts name: NI-genetic insulator
    • Sequence:
    • Description: A 16 bp polynucleotide sequence of Arabidopsis thaliana is a genetic insulatorthat can effectively isolate a transgene from positional effects of neighboring gene activities in transgenic plant cells. This sequence includes two repetitions of the 16 pb sequences. Source: US Patent US20060174370 A1